Journal: bioRxiv

Article Title: Riboflavin drives nucleotide biosynthesis and iron-sulfur metabolism to promote acute myeloid leukemia

doi: 10.1101/2025.06.26.661633

Figure Lengend Snippet: A . Volcano plot of relative fold change (log 2 ) in metabolite abundance in NB4 cells upon RFK deletion versus Rosa control at day 9 ranked by significance. The dotted line denotes P < 0.05. Blue circles, starch/sucrose/nucleotide sugar metabolism; green circles, nucleotide metabolism; yellow circles, phosphatidylethanolamine/phosphatidylcholine metabolism. B . Dot plot of genetic co-dependency of genes with RFK ranked by Pearson correlation. Data from DepMap 24Q2. Blue shading denotes nucleotide metabolism-associated genes. C . Heatmap of nucleotide metabolites in RFK deleted NB4 cells versus Rosa controls cultured in RPMI for 7 days. Relative log 2 of metabolite abundances shown. Data representative of n =4 biological replicates per condition. D . Western immunoblot for DHODH in NB4 and MV4-11 cells upon genetic KO of RFK for 9 days (left) or 4 and 7 days of exogenous riboflavin starvation (right). β-Actin served as the loading control. Blot membrane was stripped and re-probed for other proteins of interest, and data from the same gel, including loading control, are also used in Figure S5A. E . Schema of CRISPR screen using metabolic library in NB4 cells cultured in Plasmax complete or riboflavin depleted medium. F . Dot plot of genes ranked by relative log 2 enrichment or depletion in Plasmax complete versus riboflavin depleted culture medium as measured by sgRNA abundance. Genes whose abundance increased conferred resistance to riboflavin depletion. Red denotes genes associated with purine biosynthesis. G . Cell number of NB4 cells at day 6 post culture in Plasmax complete or lacking riboflavin and treated with vehicle (water), or cocktails of purine (A+G, adenosine + guanosine) or pyrimidine (C+T, cytidine + thymidine) nucleosides. Cell number normalized to Complete + Vehicle. Data representative of n =3 biological replicates. H . Cell number of MV4-11 cells at day 8 post induction of Rosa or RFK sgRNAs, treated with vehicle (water), or cocktails of purine (A+G, adenosine + guanosine) or pyrimidine (C+T, cytidine + thymidine) nucleosides in Plasmax medium for 4 days. Cell number normalized to sgRosa + Vehicle. Data representative of n =3 biological replicates. I . Western immunoblot for γH2A.X in MV4-11 cells at day 8 post induction of Rosa or RFK sgRNAs, treated with vehicle (water), or cocktails of purine (A+G, adenosine + guanosine) or pyrimidine (C+T, cytidine + thymidine) nucleosides in Plasmax medium for 4 days. Short exposure (top) and long exposure (bottom). Vinculin served as the loading control. J . Dot plot of the correlation between RFK dependency and metabolite abundance in the DepMap 24Q2 dataset ranked by significance. Each circle denotes an individual metabolite. Dotted line denotes P < 0.05. Data are presented as the mean ± SD. ** P < 0.01, *** P < 0.001 and **** P < 0.0001 by ordinary two-way ANOVA with Bonferroni’s multiple comparisons test (G, H).

Article Snippet: D.E.R. generated the metabolic CRISPR screen library at the Broad Institute Genomic Perturbation Platform (GPP) and provided critical technical and conceptual expertise.

Techniques: Control, Starch, Cell Culture, Western Blot, Membrane, CRISPR

Journal: bioRxiv

Article Title: Riboflavin drives nucleotide biosynthesis and iron-sulfur metabolism to promote acute myeloid leukemia

doi: 10.1101/2025.06.26.661633

Figure Lengend Snippet: A . Dot plot of differentially altered metabolites upon exogenous depletion of riboflavin compared to complete medium (y-axis) at day 4 (top graph) and day 7 (bottom graph), versus deletion of RFK at day 9 (both graphs, x- axis). Relative log 2 of metabolite abundances shown. Highlighted metabolites belong to the metabolic processes indicated. B . Quantification of riboflavin, FMN and FAD in NB4 cells upon 9 days of RFK knockout versus Rosa control via metabolite profiling (top) and in NB4 cells upon 4 and 7 days of exogenous riboflavin depletion versus complete medium (bottom). Normalized peak area of n =4 biological replicates for each condition shown. C . Bubble plots of gene ontology metabolite sets showing pathways associated with metabolites with decreased abundance (left) and increased abundance (right). P -values are reported. Pathway enrichment performed using MetaboAnalyst 6.0. D . Schema of the Kennedy Pathway (left) and heatmap of key pathway intermediates in NB4 cells after 9 days of RFK depletion versus Rosa control. Scale depicts normalized peak area of each metabolite. E . Dot plot of genetic co-dependency of genes with RFK ranked by Pearson correlation. Data from DepMap 24Q2. Yellow shading denotes choline metabolism-associated genes. F . Cell number of NB4 and MV4-11 cells at day 8 post induction of Rosa or RFK sgRNAs, treated with vehicle (water), or 10 mM or 20 mM aspartate in Plasmax medium for 4 days. Cell number normalized to sgRosa + Vehicle. Data representative of n =3 biological replicates. G . Schema of the design and generation of metabolism-focused CRISPR-Cas9 library. H . Cell number of MV4-11 cells at day 8 post induction of Rosa or RFK sgRNAs, treated with vehicle (water), or cocktails of purine (A+G, adenosine + guanosine) or pyrimidine (C+T, cytidine + thymidine) nucleosides in RPMI medium for 4 days. Cell number normalized to sgRosa + Vehicle. Data representative of n =3 biological replicates. I . Cell number of MV4-11 cells at day 8 post induction of Rosa or RFK sgRNAs, treated with vehicle (water), cytidine or 2’-deoxycytidine nucleosides in Plasmax medium for 4 days. Cell number normalized to sgRosa + Vehicle. Data representative of n =3 biological replicates. Data are presented as the mean ± SD. ** P < 0.01, **** P < 0.0001 by unpaired two-tailed Student’s t -test (B), and ordinary two-way ANOVA with Bonferroni’s multiple comparisons test (B, F, H, I).

Article Snippet: D.E.R. generated the metabolic CRISPR screen library at the Broad Institute Genomic Perturbation Platform (GPP) and provided critical technical and conceptual expertise.

Techniques: Knock-Out, Control, CRISPR, Two Tailed Test

Journal: bioRxiv

Article Title: Riboflavin drives nucleotide biosynthesis and iron-sulfur metabolism to promote acute myeloid leukemia

doi: 10.1101/2025.06.26.661633

Figure Lengend Snippet: A . Dot plot of genes ranked by relative log 2 enrichment or depletion in Plasmax complete versus riboflavin depleted culture medium as measured by sgRNA abundance. Genes whose abundance decreased conferred sensitivity to riboflavin depletion. Colors show indicated gene families. B . Dot plot of genetic co-dependency of genes with RFK ranked by Pearson correlation. Data from DepMap 24Q2. Purple shading indicates iron-sulfur cluster containing genes, and orange iron starvation response-associated genes. C . Simplified schema of the synthesis of [2Fe-2S] iron-sulfur clusters, their trafficking, and involvement in the synthesis of [4Fe-4S] iron-sulfur clusters. The client proteins of [4Fe-4S] clusters are highlighted, and stars indicate CRISPR screen hits that sensitize cells to death upon riboflavin starvation. D . Western immunoblot analysis of indicated proteins in cell lysates isolated from NB4 and MV4-11 cells at day 5 (left blots) and day 9 (right blots) post induction of Rosa or RFK sgRNAs. β-Actin served as the loading control. E . Volcano plot of relative fold change (log 2 ) of differentially regulated genes versus −log 10 ( P -values) in NB4 cells upon RFK deletion in RPMI medium at day 7. F . Aconitase activity (mOD/min/μg of protein) in whole-cell lysates of RFK deleted NB4 cells at day 9. mOD, milli optical density. Data representative of n =3 biological replicates. G . Cell number of NB4 and MV4-11 cells at day 7 post induction of Rosa or RFK sgRNAs, or day 7 post riboflavin starvation, treated with vehicle (DMSO, dimethyl sulfoxide), or the iron chelator deferoxamine (DFO) for 3 days. Cell number normalized to sgRosa + DMSO, or Plasmax Complete medium + DMSO. Data representative of n =3 biological replicates. Data are presented as the mean ± SD. *** P < 0.001, **** P < 0.0001 by unpaired two-tailed Student’s t -test (F) and ordinary two-way ANOVA with uncorrected Fisher’s LSD test (G).

Article Snippet: D.E.R. generated the metabolic CRISPR screen library at the Broad Institute Genomic Perturbation Platform (GPP) and provided critical technical and conceptual expertise.

Techniques: CRISPR, Western Blot, Isolation, Control, Activity Assay, Two Tailed Test

Journal: Cell reports

Article Title: Systematic discovery and functional dissection of enhancers needed for cancer cell fitness and proliferation

doi: 10.1016/j.celrep.2022.111630

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Custom library Oligos for CRISPR screen , This study , and .

Techniques: Virus, Recombinant, Ligation, Magnetic Beads, Reverse Transcription, CRISPR, Sequencing, Plasmid Preparation, Software

Journal: STAR Protocols

Article Title: Protocol for iterative enrichment of integrated sgRNAs via derivative CRISPR-Cas9 libraries from genomic DNA of sorted fixed cells

doi: 10.1016/j.xpro.2024.103493

Figure Lengend Snippet:

Article Snippet: Illumina-sgRNA_seq: PAGE purified primer for NGS of PCR products from CRISPR library screening. ACACTCTCTTGTGGAAAGGACGAAACACCG , This paper , Lab ID: Pr1435.

Techniques: Polymer, Recombinant, Purification, Modification, Saline, Cell Culture, Gel Extraction, Plasmid Preparation, Membrane, Transfection, Software, CRISPR, Library Screening